orm1 sirna  (Shanghai GenePharma)

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Regulatory role of Orm1 on the proliferation of mouse regenerating HPCs and human hepatic cells. (a) Schematic overview of loss-of-function experimental procedures. Orm1 expression at transcript levels in (b) whole-liver tissue and (c) serum protein levels. (d) IHC staining and (e) gene expression of cell proliferation marker Ki-67 in whole-liver tissue at 48 h post-PH. The average percentage of Ki-67 positive cells presented in (d) was quantified from five randomly selected areas in three slides from each mouse (n = 2–4). Scale bar, 50 μm. siCtl, control siRNA; siOrm1, Orm1 siRNA. The quantitative data were presented as the mean plus standard error (n = 4). (f) Data mining of Orm1 expression in human tissues obtained from the freely available FANTOM5 database. Reference RNA, commercially obtained universal human reference total RNA. Others, other human hepatic non-parenchymal cells, primary cells, tissues and cancer cell lines. (g) The gene expression of Orm1 was examined in human liver cancer cell lines FLC4, FLC7, and HepG2, human hepatic stellate cell line LX2, and immortalized human liver endothelial cell line M1 using real-time RT-PCR. Gene expression was normalized to that of GAPDH. Effect of Orm1 knockdown on (h) gene expression of Orm1 and cyclin D1 and (i) cell proliferation of human hepatic cell line FLC4 in the in the absence [ORM1(−)] and presence [ORM1(+)] of 25 ng/mL recombinant human Orm1. The quantitative data were presented as the mean plus the standard deviation of three replicates. * P < 0.05 assessed using two-tailed Student's t -test, Mann-Whitney U test or ANOVA with post-hoc Tukey HSD Calculator for multiple comparison.

Article Snippet: A siRNA targeting human Orm1 (sc-60133) (siOrm1) and a control siRNA (sc-37007) (siCtl) were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Immunohistochemistry, Gene Expression, Marker, Control, Quantitative RT-PCR, Knockdown, Recombinant, Standard Deviation, Two Tailed Test, MANN-WHITNEY, Comparison

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Molecular targets of Orm1 in mouse regenerating livers. Microarray analysis ( GSE83733 ) was performed in control siRNA (siCtl) and Orm1 siRNA (siOrm1)-injected mouse livers at 48 h post-PH (n = 2). (a) Heatmap visualization of 188 differentially expressed genes with a fold change of > 2 in the livers between groups of mice receiving siOrm1 or siCtl. (b) Top five associated signaling pathways performed using SEA analysis in GeneSpring GX13. (c) The top diseases or functions annotation and (d) top canonical pathway analysis performed in IPA platform. The pathways were ranked according to their-log10 of P values. The ratio indicates the number of enriched genes of interest relative to the total number of genes associated with that pathway in the IPA database. (e) Gene expression levels of MCM2 , MCM4 and MCM6 involved in the enriched “cell cycle control of chromosomal replication” singling pathway in whole-liver tissues before (PH 0 h) and at 48 h post-PH (PH 48 h) were verified using RT-PCR and presented as fold change compared to PH 0 h (n = 4). The data were presented in a Box-and-Whisker plot. * P < 0.05 assessed using the Mann-Whitney U test or two-tailed Student's t -test.

Article Snippet: A siRNA targeting human Orm1 (sc-60133) (siOrm1) and a control siRNA (sc-37007) (siCtl) were purchased from Santa Cruz Biotechnology.

Techniques: Microarray, Control, Injection, Protein-Protein interactions, Gene Expression, Reverse Transcription Polymerase Chain Reaction, Whisker Assay, MANN-WHITNEY, Two Tailed Test

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Orm1 is induced in humans and mics after PH. (a)–(c) Human data. (a) Postoperative serum Orm1 levels were examined in 10 patients who had undergone liver resection for HCC. (b) Correlation between changes in serum Orm1 at 24 h post-liver resection with the rates of liver resection (the resection volume counts per total liver volume counts). POD, postoperative days. (c) Representative photographs of IHC staining of Orm1 in commercially obtained liver sections of HCC and normal adjacent tissues in HCC patients. As a negative control (Ctl), human Orm1 antibody that had been incubated with a 5-fold (by weight) excess of blocking peptide. (d)–(g) Mouse data. (d) Time course of Orm1 gene expression in whole-liver tissues after PH (n = 3). (e) Orm1 transcript levels in whole-liver tissues and (f) serum protein levels at 48 h after PH (n = 4). (g) IHC staining of Orm1 in mouse liver tissues at 48 h after PH. P -value was assessed using Student's t -test or Mann-Whitney U test. * P < 0.05 indicates statistical significance. Scale bars, 100 μm.

Article Snippet: A siRNA targeting human Orm1 (sc-60133) (siOrm1) and a control siRNA (sc-37007) (siCtl) were purchased from Santa Cruz Biotechnology.

Techniques: Immunohistochemistry, Negative Control, Incubation, Blocking Assay, Gene Expression, MANN-WHITNEY

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Transcriptional profiling of LSECs and HPCs during liver regeneration. (a) Schematic overview of transcriptome experimental procedures (n = 3). (b) Hierarchical clustering with Ward's method of 16,499 genes measured by CAGE technology in LSECs and HPCs. The mean average from three biological replicates at each time point was shown. Low expression tags were deleted and the tags that were expressed at least at one time point in either LSECs or HPCs were kept with the expression cutoff at 1 tags per million (TPM). PCA score plots of differentially expressed genes in the process of liver regeneration for (c) LSECs and (d) HPCs. Numbers of significantly differentially expressed genes compared with the sham control at each time point in (e) LSECs and (f) HPCs. Top canonical pathways associated with significantly differentially expressed genes during liver regeneration in (g) LSECs and (h) HPCs in IPA program. Functional annotations identified using DAVID software with top (i) LSEC and (j) HPC genes selected by evaluating the relative contribution of each gene to differential gene expression during the process of liver regeneration in PLS-DA modeling. (k) Expression of Orm1 and Orm2 in LSECs and HPCs during liver regeneration measured by CAGE analysis.

Article Snippet: A siRNA targeting human Orm1 (sc-60133) (siOrm1) and a control siRNA (sc-37007) (siCtl) were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Control, Functional Assay, Software, Gene Expression

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Regulatory role of Orm1 on the proliferation of mouse regenerating HPCs and human hepatic cells. (a) Schematic overview of loss-of-function experimental procedures. Orm1 expression at transcript levels in (b) whole-liver tissue and (c) serum protein levels. (d) IHC staining and (e) gene expression of cell proliferation marker Ki-67 in whole-liver tissue at 48 h post-PH. The average percentage of Ki-67 positive cells presented in (d) was quantified from five randomly selected areas in three slides from each mouse (n = 2–4). Scale bar, 50 μm. siCtl, control siRNA; siOrm1, Orm1 siRNA. The quantitative data were presented as the mean plus standard error (n = 4). (f) Data mining of Orm1 expression in human tissues obtained from the freely available FANTOM5 database. Reference RNA, commercially obtained universal human reference total RNA. Others, other human hepatic non-parenchymal cells, primary cells, tissues and cancer cell lines. (g) The gene expression of Orm1 was examined in human liver cancer cell lines FLC4, FLC7, and HepG2, human hepatic stellate cell line LX2, and immortalized human liver endothelial cell line M1 using real-time RT-PCR. Gene expression was normalized to that of GAPDH. Effect of Orm1 knockdown on (h) gene expression of Orm1 and cyclin D1 and (i) cell proliferation of human hepatic cell line FLC4 in the in the absence [ORM1(−)] and presence [ORM1(+)] of 25 ng/mL recombinant human Orm1. The quantitative data were presented as the mean plus the standard deviation of three replicates. * P < 0.05 assessed using two-tailed Student's t -test, Mann-Whitney U test or ANOVA with post-hoc Tukey HSD Calculator for multiple comparison.

Article Snippet: A siRNA targeting human Orm1 (sc-60133) (siOrm1) and a control siRNA (sc-37007) (siCtl) were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Immunohistochemistry, Gene Expression, Marker, Control, Quantitative RT-PCR, Knockdown, Recombinant, Standard Deviation, Two Tailed Test, MANN-WHITNEY, Comparison

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Molecular targets of Orm1 in mouse regenerating livers. Microarray analysis ( GSE83733 ) was performed in control siRNA (siCtl) and Orm1 siRNA (siOrm1)-injected mouse livers at 48 h post-PH (n = 2). (a) Heatmap visualization of 188 differentially expressed genes with a fold change of > 2 in the livers between groups of mice receiving siOrm1 or siCtl. (b) Top five associated signaling pathways performed using SEA analysis in GeneSpring GX13. (c) The top diseases or functions annotation and (d) top canonical pathway analysis performed in IPA platform. The pathways were ranked according to their-log10 of P values. The ratio indicates the number of enriched genes of interest relative to the total number of genes associated with that pathway in the IPA database. (e) Gene expression levels of MCM2 , MCM4 and MCM6 involved in the enriched “cell cycle control of chromosomal replication” singling pathway in whole-liver tissues before (PH 0 h) and at 48 h post-PH (PH 48 h) were verified using RT-PCR and presented as fold change compared to PH 0 h (n = 4). The data were presented in a Box-and-Whisker plot. * P < 0.05 assessed using the Mann-Whitney U test or two-tailed Student's t -test.

Article Snippet: A siRNA targeting human Orm1 (sc-60133) (siOrm1) and a control siRNA (sc-37007) (siCtl) were purchased from Santa Cruz Biotechnology.

Techniques: Microarray, Control, Injection, Protein-Protein interactions, Gene Expression, Reverse Transcription Polymerase Chain Reaction, Whisker Assay, MANN-WHITNEY, Two Tailed Test

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Schematic diagram of a regulatory role of Orm1 on regenerating HPC proliferation. In this study, beginning with the transcriptome profiling of LSECs and HPCs during mouse liver regeneration, early transcriptional changes in injury response pathways in LSECs was observed, followed by activation of cell cycle control pathways in HPCs, and Orm1, predominantly expressed in HPCs, was found and characterized as a promising factor responsible for that by regulating HPC proliferation during liver regeneration.

Article Snippet: A siRNA targeting human Orm1 (sc-60133) (siOrm1) and a control siRNA (sc-37007) (siCtl) were purchased from Santa Cruz Biotechnology.

Techniques: Activation Assay, Control

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Orm1 is induced in humans and mics after PH. (a)–(c) Human data. (a) Postoperative serum Orm1 levels were examined in 10 patients who had undergone liver resection for HCC. (b) Correlation between changes in serum Orm1 at 24 h post-liver resection with the rates of liver resection (the resection volume counts per total liver volume counts). POD, postoperative days. (c) Representative photographs of IHC staining of Orm1 in commercially obtained liver sections of HCC and normal adjacent tissues in HCC patients. As a negative control (Ctl), human Orm1 antibody that had been incubated with a 5-fold (by weight) excess of blocking peptide. (d)–(g) Mouse data. (d) Time course of Orm1 gene expression in whole-liver tissues after PH (n = 3). (e) Orm1 transcript levels in whole-liver tissues and (f) serum protein levels at 48 h after PH (n = 4). (g) IHC staining of Orm1 in mouse liver tissues at 48 h after PH. P -value was assessed using Student's t -test or Mann-Whitney U test. * P < 0.05 indicates statistical significance. Scale bars, 100 μm.

Article Snippet: A Stealth RNAi™ Pre-Designed siRNA targeting mouse Orm1 (siOrm1), UUGAGACUCCCGAAGCUCUAUUGUG, and a paired control siRNA (siCtl), CACAAUAGAGCUUCGGGAGUCUCAA, were purchased from Life Technologies (Gaithersburg, MD, USA).

Techniques: Immunohistochemistry, Negative Control, Incubation, Blocking Assay, Expressing, MANN-WHITNEY

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Transcriptional profiling of LSECs and HPCs during liver regeneration. (a) Schematic overview of transcriptome experimental procedures (n = 3). (b) Hierarchical clustering with Ward's method of 16,499 genes measured by CAGE technology in LSECs and HPCs. The mean average from three biological replicates at each time point was shown. Low expression tags were deleted and the tags that were expressed at least at one time point in either LSECs or HPCs were kept with the expression cutoff at 1 tags per million (TPM). PCA score plots of differentially expressed genes in the process of liver regeneration for (c) LSECs and (d) HPCs. Numbers of significantly differentially expressed genes compared with the sham control at each time point in (e) LSECs and (f) HPCs. Top canonical pathways associated with significantly differentially expressed genes during liver regeneration in (g) LSECs and (h) HPCs in IPA program. Functional annotations identified using DAVID software with top (i) LSEC and (j) HPC genes selected by evaluating the relative contribution of each gene to differential gene expression during the process of liver regeneration in PLS-DA modeling. (k) Expression of Orm1 and Orm2 in LSECs and HPCs during liver regeneration measured by CAGE analysis.

Article Snippet: A Stealth RNAi™ Pre-Designed siRNA targeting mouse Orm1 (siOrm1), UUGAGACUCCCGAAGCUCUAUUGUG, and a paired control siRNA (siCtl), CACAAUAGAGCUUCGGGAGUCUCAA, were purchased from Life Technologies (Gaithersburg, MD, USA).

Techniques: Expressing, Functional Assay, Software

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Regulatory role of Orm1 on the proliferation of mouse regenerating HPCs and human hepatic cells. (a) Schematic overview of loss-of-function experimental procedures. Orm1 expression at transcript levels in (b) whole-liver tissue and (c) serum protein levels. (d) IHC staining and (e) gene expression of cell proliferation marker Ki-67 in whole-liver tissue at 48 h post-PH. The average percentage of Ki-67 positive cells presented in (d) was quantified from five randomly selected areas in three slides from each mouse (n = 2–4). Scale bar, 50 μm. siCtl, control siRNA; siOrm1, Orm1 siRNA. The quantitative data were presented as the mean plus standard error (n = 4). (f) Data mining of Orm1 expression in human tissues obtained from the freely available FANTOM5 database. Reference RNA, commercially obtained universal human reference total RNA. Others, other human hepatic non-parenchymal cells, primary cells, tissues and cancer cell lines. (g) The gene expression of Orm1 was examined in human liver cancer cell lines FLC4, FLC7, and HepG2, human hepatic stellate cell line LX2, and immortalized human liver endothelial cell line M1 using real-time RT-PCR. Gene expression was normalized to that of GAPDH. Effect of Orm1 knockdown on (h) gene expression of Orm1 and cyclin D1 and (i) cell proliferation of human hepatic cell line FLC4 in the in the absence [ORM1(−)] and presence [ORM1(+)] of 25 ng/mL recombinant human Orm1. The quantitative data were presented as the mean plus the standard deviation of three replicates. * P < 0.05 assessed using two-tailed Student's t -test, Mann-Whitney U test or ANOVA with post-hoc Tukey HSD Calculator for multiple comparison.

Article Snippet: A Stealth RNAi™ Pre-Designed siRNA targeting mouse Orm1 (siOrm1), UUGAGACUCCCGAAGCUCUAUUGUG, and a paired control siRNA (siCtl), CACAAUAGAGCUUCGGGAGUCUCAA, were purchased from Life Technologies (Gaithersburg, MD, USA).

Techniques: Expressing, Immunohistochemistry, Marker, Quantitative RT-PCR, Recombinant, Standard Deviation, Two Tailed Test, MANN-WHITNEY

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Molecular targets of Orm1 in mouse regenerating livers. Microarray analysis ( GSE83733 ) was performed in control siRNA (siCtl) and Orm1 siRNA (siOrm1)-injected mouse livers at 48 h post-PH (n = 2). (a) Heatmap visualization of 188 differentially expressed genes with a fold change of > 2 in the livers between groups of mice receiving siOrm1 or siCtl. (b) Top five associated signaling pathways performed using SEA analysis in GeneSpring GX13. (c) The top diseases or functions annotation and (d) top canonical pathway analysis performed in IPA platform. The pathways were ranked according to their-log10 of P values. The ratio indicates the number of enriched genes of interest relative to the total number of genes associated with that pathway in the IPA database. (e) Gene expression levels of MCM2 , MCM4 and MCM6 involved in the enriched “cell cycle control of chromosomal replication” singling pathway in whole-liver tissues before (PH 0 h) and at 48 h post-PH (PH 48 h) were verified using RT-PCR and presented as fold change compared to PH 0 h (n = 4). The data were presented in a Box-and-Whisker plot. * P < 0.05 assessed using the Mann-Whitney U test or two-tailed Student's t -test.

Article Snippet: A Stealth RNAi™ Pre-Designed siRNA targeting mouse Orm1 (siOrm1), UUGAGACUCCCGAAGCUCUAUUGUG, and a paired control siRNA (siCtl), CACAAUAGAGCUUCGGGAGUCUCAA, were purchased from Life Technologies (Gaithersburg, MD, USA).

Techniques: Microarray, Injection, Expressing, Reverse Transcription Polymerase Chain Reaction, Whisker Assay, MANN-WHITNEY, Two Tailed Test

Journal: EBioMedicine

Article Title: Transcriptome Analysis Uncovers a Growth-Promoting Activity of Orosomucoid-1 on Hepatocytes

doi: 10.1016/j.ebiom.2017.09.008

Figure Lengend Snippet: Schematic diagram of a regulatory role of Orm1 on regenerating HPC proliferation. In this study, beginning with the transcriptome profiling of LSECs and HPCs during mouse liver regeneration, early transcriptional changes in injury response pathways in LSECs was observed, followed by activation of cell cycle control pathways in HPCs, and Orm1, predominantly expressed in HPCs, was found and characterized as a promising factor responsible for that by regulating HPC proliferation during liver regeneration.

Article Snippet: A Stealth RNAi™ Pre-Designed siRNA targeting mouse Orm1 (siOrm1), UUGAGACUCCCGAAGCUCUAUUGUG, and a paired control siRNA (siCtl), CACAAUAGAGCUUCGGGAGUCUCAA, were purchased from Life Technologies (Gaithersburg, MD, USA).

Techniques: Activation Assay